Various totally different cell strains that exhibit a partial neuronal phenotype have been recognized, however in lots of circumstances the complete extent of their neuronal differentiation has not been instantly addressed by useful research. We have now used electrophysiology and immunofluorescence to look at the formation of synapses and the event of neuronal polarity by murine embryonic stem (ES) cells and the mouse P19 embryonic carcinoma cell line.
Inside 2-Three weeks after induction by retinoic acid, subsets of P19 and ES cells shaped excitatory synapses, mediated by glutamate receptors, or inhibitory synapses, mediated by receptors for GABA or glycine. In ES-cell cultures, each NMDA and non-NMDA receptors contributed to the excitatory postsynaptic response.
EEF1D siRNA |
20-abx914980 | Abbexa | | |
- Shipped within 5-10 working days.
|
EEF1D siRNA |
20-abx914981 | Abbexa | | |
- Shipped within 5-10 working days.
|
EEF1D siRNA |
20-abx901644 | Abbexa | | |
- Shipped within 5-10 working days.
|
EEF1D antibody |
70R-17002 | Fitzgerald | 50 ul | EUR 435.00 |
Description: Rabbit polyclonal EEF1D antibody |
EEF1D Antibody |
ABD6974 | Lifescience Market | 100 ug | EUR 438.00 |
EEF1D Antibody |
1-CSB-PA007431GA01HU | Cusabio | | |
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
EEF1D Antibody |
1-CSB-PA007431LA01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
EEF1D Antibody |
DF6974 | Affbiotech | 200ul | EUR 304.00 |
Description: EEF1D Antibody detects endogenous levels of total EEF1D. |
EEF1D antibody |
38412-100ul | SAB | 100ul | EUR 252.00 |
anti-EEF1D |
YF-PA11496 | Abfrontier | 50 ug | EUR 363.00 |
Description: Mouse polyclonal to EEF1D |
anti-EEF1D |
YF-PA11497 | Abfrontier | 100 ug | EUR 403.00 |
Description: Rabbit polyclonal to EEF1D |
anti-EEF1D |
YF-PA23623 | Abfrontier | 50 ul | EUR 334.00 |
Description: Mouse polyclonal to EEF1D |
EEF1D Polyclonal Antibody |
A54224 | EpiGentek | 100 µg | EUR 570.55 |
Description: Ask the seller for details |
EEF1D Rabbit pAb |
A2509-100ul | Abclonal | 100 ul | EUR 308.00 |
EEF1D Rabbit pAb |
A2509-200ul | Abclonal | 200 ul | EUR 459.00 |
EEF1D Rabbit pAb |
A2509-20ul | Abclonal | 20 ul | EUR 183.00 |
EEF1D Rabbit pAb |
A2509-50ul | Abclonal | 50 ul | EUR 223.00 |
EEF1D Blocking Peptide |
DF6974-BP | Affbiotech | 1mg | EUR 195.00 |
Polyclonal EEF1D Antibody |
AMM07014G | Leading Biology | 0.05mg | EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D . This antibody is tested and proven to work in the following applications: |
EEF1D Conjugated Antibody |
C38412 | SAB | 100ul | EUR 397.00 |
EEF1D cloning plasmid |
CSB-CL007431HU1-10ug | Cusabio | 10ug | EUR 654.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1944
- Sequence: atgaggagcgggaaggcctcctgcaccctggagaccgtgtgggaagacaagcacaagtatgaggaggccgagcggcgcttctacgaacacgaggccacacaggcggccgcctccgcccagcagctgccagccgaggggccagccatgaatgggcccggccaggacgaccctgagg
- Show more
|
Description: A cloning plasmid for the EEF1D gene. |
EEF1D cloning plasmid |
CSB-CL007431HU2-10ug | Cusabio | 10ug | EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 846
- Sequence: atggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaa
- Show more
|
Description: A cloning plasmid for the EEF1D gene. |
Anti-EEF1D antibody |
PAab02646 | Lifescience Market | 100 ug | EUR 355.00 |
anti- EEF1D antibody |
FNab02646 | FN Test | 100µg | EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
- Uniprot ID: P29692
- Gene ID: 1936
- Research Area: Signal Transduction, Metab
- Show more
|
Description: Antibody raised against EEF1D |
anti- EEF1D antibody |
FNab02647 | FN Test | 100µg | EUR 585.00 |
- Recommended dilution: WB: 1:500-1:2000
- IF: 1:10-1:100
- IHC: 1:50-1:500
- Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein)
- Uniprot ID: P29692
- Gene ID: 1936
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against EEF1D |
anti- EEF1D antibody |
FNab02648 | FN Test | 100µg | EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein)
- Uniprot ID: P29692
- Gene ID: 1936
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against EEF1D |
Anti-EEF1D antibody |
STJ23477 | St John"s Laboratory | 100 µl | EUR 277.00 |
Description: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19. |
Anti-EEF1D(4B12) |
YF-MA10264 | Abfrontier | 100 ug | EUR 363.00 |
Description: Mouse monoclonal to EEF1D |
Human EEF1D shRNA Plasmid |
20-abx951335 | Abbexa | | |
- Shipped within 15-20 working days.
|
Mouse EEF1D shRNA Plasmid |
20-abx975725 | Abbexa | | |
- Shipped within 15-20 working days.
|
EEF1D protein (His tag) |
80R-1713 | Fitzgerald | 50 ug | EUR 397.00 |
Description: Purified recombinant Human EEF1D protein |
EEF1D Antibody, HRP conjugated |
1-CSB-PA007431LB01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EEF1D Antibody, FITC conjugated |
1-CSB-PA007431LC01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EEF1D Antibody, Biotin conjugated |
1-CSB-PA007431LD01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rat EEF1D shRNA Plasmid |
20-abx989020 | Abbexa | | |
- Shipped within 15-20 working days.
|
EEF1D ELISA KIT|Human |
EF009298 | Lifescience Market | 96 Tests | EUR 689.00 |
EEF1D Recombinant Protein (Human) |
RP010204 | ABM | 100 ug | Ask for price |
EEF1D Recombinant Protein (Human) |
RP010207 | ABM | 100 ug | Ask for price |
EEF1D Recombinant Protein (Rat) |
RP199088 | ABM | 100 ug | Ask for price |
EEF1D Recombinant Protein (Mouse) |
RP130904 | ABM | 100 ug | Ask for price |
EEF1D Recombinant Protein (Mouse) |
RP130907 | ABM | 100 ug | Ask for price |
EEF1D Polyclonal Antibody, Biotin Conjugated |
A54221 | EpiGentek | 100 µg | EUR 570.55 |
Description: reagents widely cited |
EEF1D Polyclonal Antibody, FITC Conjugated |
A54222 | EpiGentek | 100 µg | EUR 570.55 |
Description: Ask the seller for details |
EEF1D Polyclonal Antibody, HRP Conjugated |
A54223 | EpiGentek | 100 µg | EUR 570.55 |
Description: The best epigenetics products |
Polyclonal EEF1D Antibody (N-term) |
AMM07016G | Leading Biology | 0.1ml | EUR 484.00 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D (N-term). This antibody is tested and proven to work in the following applications: |
EEF1D ORF Vector (Human) (pORF) |
ORF003402 | ABM | 1.0 ug DNA | EUR 95.00 |
EEF1D ORF Vector (Human) (pORF) |
ORF003403 | ABM | 1.0 ug DNA | EUR 95.00 |
Eef1d ORF Vector (Rat) (pORF) |
ORF066364 | ABM | 1.0 ug DNA | EUR 506.00 |
Eef1d ORF Vector (Mouse) (pORF) |
ORF043636 | ABM | 1.0 ug DNA | EUR 506.00 |
Eef1d ORF Vector (Mouse) (pORF) |
ORF043637 | ABM | 1.0 ug DNA | EUR 506.00 |
Human Elongation factor 1-delta (EEF1D) |
1-CSB-EP007431HU | Cusabio | - EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
| - 100ug
- 10ug
- 1MG
- 200ug
- 500ug
- 50ug
|
- MW: 35 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 1-delta(EEF1D) expressed in E.coli |
EEF1D sgRNA CRISPR Lentivector set (Human) |
K0657001 | ABM | 3 x 1.0 ug | EUR 339.00 |
Eef1d sgRNA CRISPR Lentivector set (Mouse) |
K4608201 | ABM | 3 x 1.0 ug | EUR 339.00 |
Eef1d sgRNA CRISPR Lentivector set (Rat) |
K7151201 | ABM | 3 x 1.0 ug | EUR 339.00 |
Monoclonal EEF1D Antibody (monoclonal) (M04), Clone: 4B12 |
AMM07015G | Leading Biology | 0.1mg | EUR 484.00 |
Description: A Monoclonal antibody against Human EEF1D (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4B12. This antibody is applicable in WB and IF, E |
EEF1D Protein Vector (Human) (pPB-C-His) |
PV013605 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPB-N-His) |
PV013606 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPM-C-HA) |
PV013607 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPM-C-His) |
PV013608 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPB-C-His) |
PV013609 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPB-N-His) |
PV013610 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPM-C-HA) |
PV013611 | ABM | 500 ng | EUR 329.00 |
EEF1D Protein Vector (Human) (pPM-C-His) |
PV013612 | ABM | 500 ng | EUR 329.00 |
EEF1D sgRNA CRISPR Lentivector (Human) (Target 1) |
K0657002 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF1D sgRNA CRISPR Lentivector (Human) (Target 2) |
K0657003 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF1D sgRNA CRISPR Lentivector (Human) (Target 3) |
K0657004 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4608202 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4608203 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4608204 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1d sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7151202 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1d sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7151203 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1d sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7151204 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF1D Protein Vector (Mouse) (pPB-C-His) |
PV174542 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPB-N-His) |
PV174543 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPM-C-HA) |
PV174544 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPM-C-His) |
PV174545 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPB-C-His) |
PV174546 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPB-N-His) |
PV174547 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPM-C-HA) |
PV174548 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Mouse) (pPM-C-His) |
PV174549 | ABM | 500 ng | EUR 603.00 |
EEF1D 3"UTR Luciferase Stable Cell Line |
TU006621 | ABM | 1.0 ml | EUR 1394.00 |
EEF1D 3"UTR GFP Stable Cell Line |
TU056621 | ABM | 1.0 ml | EUR 1394.00 |
EEF1D Protein Vector (Rat) (pPB-C-His) |
PV265454 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Rat) (pPB-N-His) |
PV265455 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Rat) (pPM-C-HA) |
PV265456 | ABM | 500 ng | EUR 603.00 |
EEF1D Protein Vector (Rat) (pPM-C-His) |
PV265457 | ABM | 500 ng | EUR 603.00 |
Eef1d 3"UTR GFP Stable Cell Line |
TU253790 | ABM | 1.0 ml | Ask for price |
Eef1d 3"UTR Luciferase Stable Cell Line |
TU105612 | ABM | 1.0 ml | Ask for price |
Eef1d 3"UTR Luciferase Stable Cell Line |
TU203790 | ABM | 1.0 ml | Ask for price |
Eef1d 3"UTR GFP Stable Cell Line |
TU155612 | ABM | 1.0 ml | Ask for price |
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
abx032848-400ul | Abbexa | 400 ul | EUR 523.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
abx032848-80l | Abbexa | 80 µl | EUR 286.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
20-abx001951 | Abbexa | - EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
| |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Antibody |
20-abx176323 | Abbexa | - EUR 425.00
- EUR 133.00
- EUR 1205.00
- EUR 578.00
- EUR 328.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Antibody |
20-abx176324 | Abbexa | - EUR 439.00
- EUR 133.00
- EUR 1233.00
- EUR 592.00
- EUR 328.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
20-abx112351 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
20-abx109748 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
abx122804-100ug | Abbexa | 100 ug | EUR 391.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
20-abx225153 | Abbexa | - EUR 370.00
- EUR 606.00
- EUR 314.00
| |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
abx232646-100ug | Abbexa | 100 ug | EUR 481.00 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
abx232647-100ug | Abbexa | 100 ug | EUR 551.00 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody |
abx232648-100ug | Abbexa | 100 ug | EUR 509.00 |
- Shipped within 5-12 working days.
|
Human Elongation Factor 1 Delta (EEF1D) ELISA Kit |
abx387054-96tests | Abbexa | 96 tests | EUR 911.00 |
- Shipped within 5-12 working days.
|
Bovine Elongation factor 1- delta, EEF1D ELISA KIT |
ELI-09301b | Lifescience Market | 96 Tests | EUR 928.00 |
Mouse Elongation factor 1- delta, Eef1d ELISA KIT |
ELI-10015m | Lifescience Market | 96 Tests | EUR 865.00 |
Rabbit Elongation factor 1- delta, EEF1D ELISA KIT |
ELI-47136Ra | Lifescience Market | 96 Tests | EUR 928.00 |
Human Elongation factor 1- delta, EEF1D ELISA KIT |
ELI-47510h | Lifescience Market | 96 Tests | EUR 824.00 |
EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV679495 | ABM | 1.0 ug DNA | EUR 682.00 |
EEF1D Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV679499 | ABM | 1.0 ug DNA | EUR 682.00 |
EEF1D Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV679500 | ABM | 1.0 ug DNA | EUR 682.00 |
EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV709593 | ABM | 1.0 ug DNA | EUR 316.00 |
EEF1D Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV709597 | ABM | 1.0 ug DNA | EUR 316.00 |
EEF1D Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV709598 | ABM | 1.0 ug DNA | EUR 316.00 |
Recombinant Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) |
4-RPF024Hu01 | Cloud-Clone | - EUR 386.72
- EUR 206.00
- EUR 1175.20
- EUR 458.40
- EUR 816.80
- EUR 322.00
- EUR 2788.00
| - 100 ug
- 10ug
- 1 mg
- 200 ug
- 500 ug
- 50ug
- 5 mg
|
- Uniprot ID: P29692
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Delta expressed in: E.coli |
Recombinant Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) |
4-RPF024Mu01 | Cloud-Clone | - EUR 413.60
- EUR 214.00
- EUR 1276.00
- EUR 492.00
- EUR 884.00
- EUR 340.00
- EUR 3040.00
| - 100 ug
- 10ug
- 1 mg
- 200 ug
- 500 ug
- 50ug
- 5 mg
|
- Uniprot ID: P57776
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Eukaryotic Translation Elongation Factor 1 Delta expressed in: E.coli |
Human Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Protein |
20-abx650635 | Abbexa | - EUR 551.00
- EUR 244.00
- EUR 1595.00
- EUR 648.00
- EUR 411.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Mouse Eukaryotic Translation Elongation Factor 1 Delta (EEF1d) Protein |
20-abx650636 | Abbexa | - EUR 578.00
- EUR 258.00
- EUR 1720.00
- EUR 690.00
- EUR 425.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (Biotin) |
20-abx105372 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (FITC) |
20-abx106791 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Delta (EEF1D) Antibody (HRP) |
20-abx108210 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
EEF1D Eukaryotic Translation Elongation Factor 1 Delta Human Recombinant Protein |
PROTP29692 | BosterBio | Regular: 10ug | EUR 317.00 |
Description: EEF1D Human Recombinant fused with a20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing301 amino acids (1-281 a.a.) and having a molecular mass of 33.2kDa (Molecular weight on SDS-PAGE will appear higher). The EEF1D is purified by proprietary chromatographic techniques. |
EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0657005 | ABM | 3 x 1.0 ug | EUR 376.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4608205 | ABM | 3 x 1.0 ug | EUR 376.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K7151205 | ABM | 3 x 1.0 ug | EUR 376.00 |
EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0657006 | ABM | 1.0 ug DNA | EUR 167.00 |
EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0657007 | ABM | 1.0 ug DNA | EUR 167.00 |
EEF1D sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0657008 | ABM | 1.0 ug DNA | EUR 167.00 |
EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV679496 | ABM | 1.0 ug DNA | EUR 682.00 |
EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV679497 | ABM | 1.0 ug DNA | EUR 740.00 |
EEF1D Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV679498 | ABM | 1.0 ug DNA | EUR 740.00 |
EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV709594 | ABM | 1.0 ug DNA | EUR 316.00 |
EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV709595 | ABM | 1.0 ug DNA | EUR 374.00 |
EEF1D Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV709596 | ABM | 1.0 ug DNA | EUR 374.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4608206 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4608207 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4608208 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K7151206 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K7151207 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1d sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K7151208 | ABM | 1.0 ug DNA | EUR 167.00 |
Staining with antibodies to growth-associated protein-43 and microtubule-associated protein-2 revealed segregation of immunoreactivity into separate axonal and somato-dendritic compartments, respectively. In keeping with our physiological proof for synapse formation, intense punctate staining was noticed with antibodies to the synaptic vesicle proteins synapsin, SV2, and synaptophysin. These outcomes exhibit the in vitro acquisition by pluri-potent cell strains of neuronal polarity and useful synaptic transmission that’s attribute of CNS neurons.