Preimplantation improvement within the mouse is characterised by the incidence of a number of important genetic and epigenetic occasions. Till just lately, little or no was recognized in regards to the regulation of those occasions. The seek for genes that are concerned within the management of the earliest phases of mouse improvement has to date resulted in just a few candidates. Oct-4, a member of the POU transcription issue household, is encoded by a gene belonging to this group.
Initially current as a maternal issue within the oocyte, Oct-Four is expressed by the embryo all through the preimplantation interval, in addition to in germ cell precursors of grownup mice. Oct-Four expression is correlated with an undifferentiated phenotype, each within the embryo and in cell traces derived from it.
Regulation of the Oct-Four gene depends on the exercise of two separate enhancers, certainly one of which is particularly energetic in pluri– and totipotent cells. Its operate as a transcriptional regulator is supported by the identification of an growing variety of potential goal genes, together with some recognized to be important for early embryonic improvement.
Early steps in microbial colonization processes at deep-sea hydrothermal vents.
A pluri-disciplinary in situ colonization experiment was carried out to review early phases of colonization in deep-sea vent Alvinella spp. worm habitats. 4 colonization units have been deployed onto Alvinella spp. colonies of various chimneys of the East-Pacific Rise (EPR 13 levels N), for 2 completely different intervals: a brief (lower than every week) and an extended one (three weeks).
Video imagery and monitoring of the thermal and physico-chemical situations have been carried out in the course of the colonization experiments. Quite a few microorganisms bearing specialised adhesion-appendages and/or excessive quantities of polymeric extracellular matrix have been noticed on units, which can effectively contribute to the colonization of recent surfaces. The microbial cohorts previous and accompanying Alvinella spp. settlement have been recognized.
EEF2 siRNA |
20-abx914989 | Abbexa | | |
- Shipped within 5-10 working days.
|
EEF2 siRNA |
20-abx901647 | Abbexa | | |
- Shipped within 5-10 working days.
|
EEF2 antibody |
70R-2318 | Fitzgerald | 50 ug | EUR 467.00 |
Description: Rabbit polyclonal EEF2 antibody raised against the N terminal of EEF2 |
eEF2 antibody |
70R-31022 | Fitzgerald | 100 ug | EUR 327.00 |
Description: Rabbit polyclonal eEF2 antibody |
EEF2 antibody |
70R-51523 | Fitzgerald | 100 ul | EUR 244.00 |
Description: Purified Polyclonal EEF2 antibody |
EEF2 antibody |
70R-17005 | Fitzgerald | 50 ul | EUR 435.00 |
Description: Rabbit polyclonal EEF2 antibody |
EEF2 Antibody |
ABD6798 | Lifescience Market | 100 ug | EUR 438.00 |
EEF2 Antibody |
1-CSB-PA002260 | Cusabio | | |
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
EEF2 Antibody |
1-CSB-PA007434GA01HU | Cusabio | | |
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EEF2 Antibody |
1-CSB-PA007434LA01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
EEF2 Antibody |
1-CSB-PA090786 | Cusabio | | |
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100 |
EEF2 Antibody |
1-CSB-PA994433 | Cusabio | | |
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100 |
EEF2 Antibody |
DF6798 | Affbiotech | 200ul | EUR 304.00 |
Description: EEF2 Antibody detects endogenous levels of total EEF2. |
EEF2 antibody |
10R-10728 | Fitzgerald | 100 ug | EUR 381.00 |
Description: Mouse monoclonal EEF2 antibody |
EEF2 antibody |
10R-11163 | Fitzgerald | 100 ug | EUR 349.00 |
Description: Mouse Monoclonal EEF2 antibody |
EEF2 Antibody |
32582-100ul | SAB | 100ul | EUR 252.00 |
eEF2 Antibody |
AF7720 | Affbiotech | 200ul | EUR 376.00 |
Description: eEF2 Antibody detects endogenous levels of eEF2. |
eEF2 Antibody |
AF7721 | Affbiotech | 200ul | EUR 376.00 |
Description: eEF2 Antibody detects endogenous levels of eEF2. |
EEF2 Antibody |
BF0405 | Affbiotech | 200ul | EUR 376.00 |
Description: EEF2 antibody detects endogenous levels of total EEF2. |
EEF2 Polyclonal Antibody |
E-AB-36536-120uL | Elabscience Biotechnology | 120uL | EUR 257.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-36536-20uL | Elabscience Biotechnology | 20uL | EUR 130.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-36536-60uL | Elabscience Biotechnology | 60uL | EUR 175.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-40218-120uL | Elabscience Biotechnology | 120uL | EUR 257.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an ess
- Show more
|
Description: Rabbit antibody against Human EEF2 for IHC applications. |
EEF2 Polyclonal Antibody |
E-AB-40218-20uL | Elabscience Biotechnology | 20uL | EUR 130.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an ess
- Show more
|
Description: Rabbit antibody against Human EEF2 for IHC applications. |
EEF2 Polyclonal Antibody |
E-AB-40218-60uL | Elabscience Biotechnology | 60uL | EUR 175.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.05% Proclin300, 50% glycerol, pH7.3.
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an ess
- Show more
|
Description: Rabbit antibody against Human EEF2 for IHC applications. |
EEF2 Rabbit pAb |
A0099-100ul | Abclonal | 100 ul | EUR 308.00 |
EEF2 Rabbit pAb |
A0099-200ul | Abclonal | 200 ul | EUR 459.00 |
EEF2 Rabbit pAb |
A0099-20ul | Abclonal | 20 ul | EUR 183.00 |
EEF2 Rabbit pAb |
A0099-50ul | Abclonal | 50 ul | EUR 223.00 |
EEF2 Polyclonal Antibody |
A53432 | EpiGentek | 100 µg | EUR 570.55 |
Description: reagents widely cited |
EEF2 Rabbit pAb |
A2068-100ul | Abclonal | 100 ul | EUR 308.00 |
EEF2 Rabbit pAb |
A2068-200ul | Abclonal | 200 ul | EUR 459.00 |
EEF2 Rabbit pAb |
A2068-20ul | Abclonal | 20 ul | EUR 183.00 |
EEF2 Rabbit pAb |
A2068-50ul | Abclonal | 50 ul | EUR 223.00 |
eEF2 antibody (Thr56) |
70R-31021 | Fitzgerald | 100 ug | EUR 327.00 |
Description: Rabbit polyclonal eEF2 antibody (Thr56) |
EEF2 Blocking Peptide |
DF6798-BP | Affbiotech | 1mg | EUR 195.00 |
EEF2 Blocking Peptide |
33R-9020 | Fitzgerald | 100 ug | EUR 180.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF2 antibody, catalog no. 70R-2318 |
EEF2 Monoclonal Antibody |
27102-100ul | SAB | 100ul | EUR 252.00 |
EEF2 Monoclonal Antibody |
27102-50ul | SAB | 50ul | EUR 187.00 |
EEF2 Blocking Peptide |
20-abx062098 | Abbexa | | |
- Shipped within 5-10 working days.
|
eEF2 Polyclonal Antibody |
ABP58457-003ml | Abbkine | 0.03ml | EUR 158.00 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
eEF2 Polyclonal Antibody |
ABP58457-01ml | Abbkine | 0.1ml | EUR 289.00 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
eEF2 Polyclonal Antibody |
ABP58457-02ml | Abbkine | 0.2ml | EUR 414.00 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
EEF2 Polyclonal Antibody |
E-AB-11179-120uL | Elabscience Biotechnology | 120uL | EUR 257.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an es
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-11179-20uL | Elabscience Biotechnology | 20uL | EUR 130.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an es
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-11179-60uL | Elabscience Biotechnology | 60uL | EUR 175.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an es
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-31275-120uL | Elabscience Biotechnology | 120uL | EUR 257.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC-p,IF,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-31275-20uL | Elabscience Biotechnology | 20uL | EUR 130.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC-p,IF,ELISA applications. |
EEF2 Polyclonal Antibody |
E-AB-31275-60uL | Elabscience Biotechnology | 60uL | EUR 175.00 |
- Conjugation: Unconjugated
- Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
- Purified by: Affinity purification
- Background: This gene encodes a member of the GTP-binding translation elongation factor family. This pro
- Show more
|
Description: Rabbit antibody against Human,Mouse,Rat EEF2 for WB,IHC-p,IF,ELISA applications. |
EEF2 (pT56) Antibody |
20-abx121387 | Abbexa | - EUR 314.00
- EUR 467.00
- EUR 203.00
| |
- Shipped within 5-10 working days.
|
eEF2 Blocking Peptide |
AF7720-BP | Affbiotech | 1mg | EUR 195.00 |
eEF2 Blocking Peptide |
AF7721-BP | Affbiotech | 1mg | EUR 195.00 |
EEF2 Blocking Peptide |
BF0405-BP | Affbiotech | 1mg | EUR 195.00 |
EEF2 Conjugated Antibody |
C32582 | SAB | 100ul | EUR 397.00 |
EEF2 cloning plasmid |
CSB-CL007434HU-10ug | Cusabio | 10ug | EUR 558.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2577
- Sequence: atggtgaacttcacggtagaccagatccgcgccatcatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaagtccacgctgacagactccctggtgtgcaaggcgggcatcatcgcctcggcccgggccggggagacacgcttcactgata
- Show more
|
Description: A cloning plasmid for the EEF2 gene. |
Anti-EEF2 antibody |
PAab02651 | Lifescience Market | 100 ug | EUR 412.00 |
anti- EEF2 antibody |
FNab02651 | FN Test | 100µg | EUR 585.00 |
- Immunogen: eukaryotic translation elongation factor 2
- Uniprot ID: P13639
- Gene ID: 1938
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against EEF2 |
eEF2, Rabbit Reticulocytes |
P1316-10 | Biovision | | EUR 370.00 |
anti-EEF2 (5B6) |
LF-MA30553 | Abfrontier | 100 ul | EUR 527.00 |
Description: Mouse Monoclonal to EEF2 |
Anti-EEF2 antibody |
STJ114864 | St John"s Laboratory | 100 µl | EUR 277.00 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
Anti-EEF2 antibody |
STJ23480 | St John"s Laboratory | 100 µl | EUR 277.00 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
Anti-eEF2 antibody |
STJ99117 | St John"s Laboratory | 200 µl | EUR 197.00 |
Description: Mouse monoclonal to eEF2. |
Anti-eEF2 antibody |
STJ99607 | St John"s Laboratory | 200 µl | EUR 197.00 |
Description: Rabbit polyclonal to eEF2. |
Mouse EEF2 shRNA Plasmid |
20-abx970115 | Abbexa | | |
- Shipped within 15-20 working days.
|
Human EEF2 shRNA Plasmid |
20-abx951337 | Abbexa | | |
- Shipped within 15-20 working days.
|
EEF2 protein (His tag) |
80R-3897 | Fitzgerald | 100 ug | EUR 327.00 |
Description: Purified recombinant EEF2 protein (His tag) |
Phospho- eEF2(Thr56)Antibody |
ABF3572 | Lifescience Market | 100 ug | EUR 438.00 |
EEF2 recombinant monoclonal antibody |
A5481 | Bimake | 100ul X 3 | EUR 595.00 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human EEF2 for WB, IHC, IF,ELISA |
EEF2 Antibody, HRP conjugated |
1-CSB-PA007434LB01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EEF2 Antibody, FITC conjugated |
1-CSB-PA007434LC01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EEF2 Antibody, Biotin conjugated |
1-CSB-PA007434LD01HU | Cusabio | | |
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
eEF2(Phospho-Tyr443) Antibody |
13078-100ul | SAB | 100ul | EUR 252.00 |
eEF2(Phospho-Tyr443) Antibody |
13078-50ul | SAB | 50ul | EUR 187.00 |
eEF2(Phospho-Thr57) Antibody |
13079-100ul | SAB | 100ul | EUR 252.00 |
eEF2(Phospho-Thr57) Antibody |
13079-50ul | SAB | 50ul | EUR 187.00 |
Phospho-EEF2 (T56) Antibody |
1-CSB-PA007904 | Cusabio | | |
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-EEF2 (T56). Recognizes Phospho-EEF2 (T56) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
EEF2 (pT56) Blocking Peptide |
20-abx162401 | Abbexa | | |
- Shipped within 5-10 working days.
|
Phospho-eEF2 (Tyr443) Antibody |
AF7220 | Affbiotech | 200ul | EUR 376.00 |
Description: Phospho-eEF2 (Tyr443) Antibody detects endogenous levels of eEF2only when phosphorylated at Tyr443. |
Phospho-eEF2 (Thr57) Antibody |
AF7221 | Affbiotech | 200ul | EUR 376.00 |
Description: Phospho-eEF2 (Thr57) Antibody detects endogenous levels of eEF2only when phosphorylated at Thr57. |
Rat EEF2 shRNA Plasmid |
20-abx985590 | Abbexa | | |
- Shipped within 15-20 working days.
|
EEF2 Conjugated Monoclonal Antibody |
C27102 | SAB | 100ul | EUR 397.00 |
Anti-EEF2 Monoclonal Antibody |
M00830-1 | BosterBio | 100ug | EUR 397.00 |
Description: Rabbit Monoclonal EEF2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
EEF2 ELISA KIT|Human |
EF004938 | Lifescience Market | 96 Tests | EUR 689.00 |
pCMV-HA-EEF2 Plasmid |
PVTB00283-2a | Lifescience Market | 2 ug | EUR 356.00 |
EEF2 Polyclonal Antibody, Biotin Conjugated |
A53429 | EpiGentek | 100 µg | EUR 570.55 |
Description: fast delivery possible |
EEF2 Polyclonal Antibody, FITC Conjugated |
A53430 | EpiGentek | 100 µg | EUR 570.55 |
Description: reagents widely cited |
EEF2 Polyclonal Antibody, HRP Conjugated |
A53431 | EpiGentek | 100 µg | EUR 570.55 |
Description: Ask the seller for details |
Mouse Elongation factor 2 (Eef2) |
1-CSB-YP007434MO | Cusabio | - EUR 504.00
- EUR 265.00
- EUR 1832.00
- EUR 763.00
- EUR 1216.00
- EUR 334.00
| - 100ug
- 10ug
- 1MG
- 200ug
- 500ug
- 50ug
|
- MW: 97.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Elongation factor 2(Eef2) expressed in Yeast |
eEF2 (Phospho-Thr56) Polyclonal Antibody |
ABP58456-003ml | Abbkine | 0.03ml | EUR 158.00 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein |
eEF2 (Phospho-Thr56) Polyclonal Antibody |
ABP58456-01ml | Abbkine | 0.1ml | EUR 289.00 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein |
eEF2 (Phospho-Thr56) Polyclonal Antibody |
ABP58456-02ml | Abbkine | 0.2ml | EUR 414.00 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein |
Human Elongation factor 2 (EEF2) |
1-CSB-EP007434HU | Cusabio | - EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
| - 100ug
- 10ug
- 1MG
- 200ug
- 500ug
- 50ug
|
- MW: 99.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 2(EEF2) expressed in E.coli |
Monoclonal EEF2 Antibody, Clone: 5B6 |
APR07656G | Leading Biology | 0.1ml | EUR 528.00 |
Description: A Monoclonal antibody against Human EEF2. The antibodies are raised in Mouse and are from clone 5B6. This antibody is applicable in WB and IHC, ICC, E |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-100ul | Abclonal | 100 ul | EUR 384.00 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-200ul | Abclonal | 200 ul | EUR 554.00 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-20ul | Abclonal | 20 ul | EUR 183.00 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-50ul | Abclonal | 50 ul | EUR 265.00 |
Phospho-eEF2 (Tyr443) Blocking Peptide |
AF7220-BP | Affbiotech | 1mg | EUR 195.00 |
Phospho-eEF2 (Thr57) Blocking Peptide |
AF7221-BP | Affbiotech | 1mg | EUR 195.00 |
eEF2(Phospho-Tyr443) Conjugated Antibody |
C13078 | SAB | 100ul | EUR 397.00 |
eEF2(Phospho-Thr57) Conjugated Antibody |
C13079 | SAB | 100ul | EUR 397.00 |
EEF2 ORF Vector (Human) (pORF) |
ORF012901 | ABM | 1.0 ug DNA | EUR 95.00 |
Eef2 ORF Vector (Rat) (pORF) |
ORF066367 | ABM | 1.0 ug DNA | EUR 506.00 |
Eef2 ORF Vector (Mouse) (pORF) |
ORF043640 | ABM | 1.0 ug DNA | EUR 506.00 |
Anti-Phospho-EEF2-T56 antibody |
STJ11100973 | St John"s Laboratory | 100 µl | EUR 393.00 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
pCDNA3.1- EEF2- Myc- 6*His |
PVT10365 | Lifescience Market | 2 ug | EUR 337.00 |
Anti-Phospho-eEF2 (Thr56) antibody |
STJ99592 | St John"s Laboratory | 200 µl | EUR 197.00 |
Description: Rabbit polyclonal to Phospho-eEF2 (Thr56). |
Anti-EEF2 Antibody (4B3-G7-H5) |
A1314-100 | Biovision | | EUR 338.00 |
EEF2 sgRNA CRISPR Lentivector set (Human) |
K0657801 | ABM | 3 x 1.0 ug | EUR 339.00 |
eEF2 Colorimetric Cell-Based ELISA Kit |
EKC1180 | BosterBio | 100ul | EUR 572.00 |
Eef2 sgRNA CRISPR Lentivector set (Rat) |
K6785201 | ABM | 3 x 1.0 ug | EUR 339.00 |
Eef2 sgRNA CRISPR Lentivector set (Mouse) |
K3928501 | ABM | 3 x 1.0 ug | EUR 339.00 |
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx214410 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx214411 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx270289 | Abbexa | - EUR 495.00
- EUR 578.00
- EUR 286.00
- EUR 885.00
- EUR 370.00
| - 100 tests
- 200 tests
- 25 tests
- 500 tests
- 50 tests
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx329583 | Abbexa | | |
- Shipped within 5-10 working days.
|
Cow Elongation Factor 2 (EEF2) ELISA Kit |
abx521279-96tests | Abbexa | 96 tests | EUR 911.00 |
- Shipped within 5-12 working days.
|
Chicken Elongation Factor 2 (EEF2) ELISA Kit |
abx521280-96tests | Abbexa | 96 tests | EUR 911.00 |
- Shipped within 5-12 working days.
|
Human Elongation Factor 2 (EEF2) ELISA Kit |
abx521281-96tests | Abbexa | 96 tests | EUR 739.00 |
- Shipped within 5-12 working days.
|
Rat Elongation Factor 2 (EEF2) ELISA Kit |
abx521283-96tests | Abbexa | 96 tests | EUR 739.00 |
- Shipped within 5-12 working days.
|
Mouse Elongation Factor 2 (EEF2) ELISA Kit |
abx255169-96tests | Abbexa | 96 tests | EUR 739.00 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Protein |
20-abx261366 | Abbexa | - EUR 3418.00
- EUR 328.00
- EUR 230.00
| |
- Shipped within 5-10 working days.
|
Human elongation factor 2(eEF2) ELISA Kit |
CSB-E13572h-24T | Cusabio | 1 plate of 24 wells | EUR 165.00 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2 (eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human elongation factor 2(eEF2) ELISA Kit |
1-CSB-E13572h | Cusabio | - EUR 900.00
- EUR 5476.00
- EUR 2900.00
| - 1 plate of 96 wells
- 10 plates of 96 wells each
- 5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2(eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx012012-100ul | Abbexa | 100 ul | EUR 411.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx001685 | Abbexa | - EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
| |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx007526 | Abbexa | - EUR 300.00
- EUR 439.00
- EUR 189.00
| |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx130986 | Abbexa | - EUR 425.00
- EUR 133.00
- EUR 1205.00
- EUR 578.00
- EUR 328.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx159481-100ul | Abbexa | 100 ul | EUR 467.00 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx112354 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx109749 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx232651-100ug | Abbexa | 100 ug | EUR 551.00 |
- Shipped within 5-12 working days.
|
Rat Eef2/ Elongation factor 2 ELISA Kit |
E0319Ra | Sunlong | 1 Kit | EUR 646.00 |
EEF2 Protein Vector (Human) (pPB-C-His) |
PV051601 | ABM | 500 ng | EUR 481.00 |
EEF2 Protein Vector (Human) (pPB-N-His) |
PV051602 | ABM | 500 ng | EUR 481.00 |
EEF2 Protein Vector (Human) (pPM-C-HA) |
PV051603 | ABM | 500 ng | EUR 481.00 |
EEF2 Protein Vector (Human) (pPM-C-His) |
PV051604 | ABM | 500 ng | EUR 481.00 |
EEF2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0657802 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0657803 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0657804 | ABM | 1.0 ug DNA | EUR 154.00 |
Mouse Eef2(Elongation factor 2) ELISA Kit |
EM0821 | FN Test | 96T | EUR 567.60 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P58252
- Alias: Eef2/EF-2/EF2EEF-2/elongation factor 2/eukaryotic translation elongation factor 2/polypeptidyl-tRNA translocase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
Human EEF2/ Elongation factor 2 ELISA Kit |
E0763Hu | Sunlong | 1 Kit | EUR 605.00 |
Mouse Eef2/ Elongation factor 2 ELISA Kit |
E0450Mo | Sunlong | 1 Kit | EUR 632.00 |
Chicken Elongation factor 2, EEF2 ELISA KIT |
ELI-09302c | Lifescience Market | 96 Tests | EUR 928.00 |
Human Elongation factor 2, EEF2 ELISA KIT |
ELI-09303h | Lifescience Market | 96 Tests | EUR 824.00 |
Rat Elongation factor 2, Eef2 ELISA KIT |
ELI-32279r | Lifescience Market | 96 Tests | EUR 886.00 |
Mouse Elongation factor 2, Eef2 ELISA KIT |
ELI-32416m | Lifescience Market | 96 Tests | EUR 865.00 |
Rabbit Elongation factor 2, EEF2 ELISA KIT |
ELI-26044Ra | Lifescience Market | 96 Tests | EUR 928.00 |
Bovine Elongation factor 2, EEF2 ELISA KIT |
ELI-26079b | Lifescience Market | 96 Tests | EUR 928.00 |
Eef2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6785202 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6785203 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6785204 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3928502 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3928503 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3928504 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF2 Protein Vector (Mouse) (pPB-C-His) |
PV174558 | ABM | 500 ng | EUR 1065.00 |
EEF2 Protein Vector (Mouse) (pPB-N-His) |
PV174559 | ABM | 500 ng | EUR 1065.00 |
EEF2 Protein Vector (Mouse) (pPM-C-HA) |
PV174560 | ABM | 500 ng | EUR 1065.00 |
EEF2 Protein Vector (Mouse) (pPM-C-His) |
PV174561 | ABM | 500 ng | EUR 1065.00 |
EEF2 3"UTR Luciferase Stable Cell Line |
TU006629 | ABM | 1.0 ml | EUR 1394.00 |
EEF2 3"UTR GFP Stable Cell Line |
TU056629 | ABM | 1.0 ml | EUR 1394.00 |
EEF2 Protein Vector (Rat) (pPB-C-His) |
PV265466 | ABM | 500 ng | EUR 1166.00 |
EEF2 Protein Vector (Rat) (pPB-N-His) |
PV265467 | ABM | 500 ng | EUR 1166.00 |
EEF2 Protein Vector (Rat) (pPM-C-HA) |
PV265468 | ABM | 500 ng | EUR 1166.00 |
EEF2 Protein Vector (Rat) (pPM-C-His) |
PV265469 | ABM | 500 ng | EUR 1166.00 |
Recombinant Eukaryotic Translation Elongation Factor 2 (EEF2) |
4-RPC453Hu01 | Cloud-Clone | - EUR 350.88
- EUR 197.00
- EUR 1040.80
- EUR 413.60
- EUR 727.20
- EUR 298.00
- EUR 2452.00
| - 100 ug
- 10ug
- 1 mg
- 200 ug
- 500 ug
- 50ug
- 5 mg
|
- Uniprot ID: P13639
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Eukaryotic Translation Elongation Factor 2 expressed in: E.coli |
Eef2 3"UTR GFP Stable Cell Line |
TU253793 | ABM | 1.0 ml | Ask for price |
Eef2 3"UTR Luciferase Stable Cell Line |
TU105615 | ABM | 1.0 ml | Ask for price |
Eef2 3"UTR Luciferase Stable Cell Line |
TU203793 | ABM | 1.0 ml | Ask for price |
Eef2 3"UTR GFP Stable Cell Line |
TU155615 | ABM | 1.0 ml | Ask for price |
Eukaryotic Translation Elongation Factor 2 (EEF2) ELISA Kit |
abx595189-96tests | Abbexa | 96 tests | EUR 637.00 |
- Shipped within 1-2 weeks.
|
Human Eukaryotic Translation Elongation Factor 2 (EEF2) Protein |
20-abx168971 | Abbexa | - EUR 495.00
- EUR 244.00
- EUR 1414.00
- EUR 578.00
- EUR 356.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (Biotin) |
20-abx105373 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (FITC) |
20-abx106792 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (HRP) |
20-abx108211 | Abbexa | - EUR 411.00
- EUR 1845.00
- EUR 599.00
- EUR 182.00
- EUR 300.00
| - 100 ug
- 1 mg
- 200 ug
- 20 ug
- 50 ug
|
- Shipped within 5-10 working days.
|
eEF2 (Phospho-Thr56) Colorimetric Cell-Based ELISA Kit |
EKC1985 | BosterBio | 100ul | EUR 572.00 |
EEF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV671713 | ABM | 1.0 ug DNA | EUR 1355.00 |
EEF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV671717 | ABM | 1.0 ug DNA | EUR 1355.00 |
EEF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV671718 | ABM | 1.0 ug DNA | EUR 1355.00 |
EEF2 Eukaryotic Translation Elongation Factor 2 Human Recombinant Protein |
PROTP13639 | BosterBio | Regular: 20ug | EUR 317.00 |
Description: EEF2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 308 amino acids (574-858) and having a molecular mass of 34.3kDa.;EEF2 is fused to a 23 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human) |
4-PAC453Hu01 | Cloud-Clone | - EUR 247.00
- EUR 2510.00
- EUR 625.00
- EUR 310.00
- EUR 214.00
| |
- Sequence of the immunogen: EEF2 (Lys32~Val233)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2) |
Eef2ELISA Kit| Rat Elongation factor 2 ELISA Kit |
EF018655 | Lifescience Market | 96 Tests | EUR 689.00 |
EEF2ELISA Kit| Bovine Elongation factor 2 ELISA Kit |
EF011366 | Lifescience Market | 96 Tests | EUR 689.00 |
EEF2ELISA Kit| chicken Elongation factor 2 ELISA Kit |
EF012297 | Lifescience Market | 96 Tests | EUR 689.00 |
Eef2 ELISA Kit| Mouse Elongation factor 2 ELISA Kit |
EF013430 | Lifescience Market | 96 Tests | EUR 689.00 |
Eukaryotic Translation Elongation Factor 2 Phospho-Thr56 (EEF2 pT56) Antibody |
20-abx329168 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), APC |
4-PAC453Hu01-APC | Cloud-Clone | - EUR 345.00
- EUR 3275.00
- EUR 912.00
- EUR 440.00
- EUR 219.00
| |
- Sequence of the immunogen: EEF2 (Lys32~Val233)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with APC. |
Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), Biotinylated |
4-PAC453Hu01-Biotin | Cloud-Clone | - EUR 311.00
- EUR 2460.00
- EUR 727.00
- EUR 381.00
- EUR 219.00
| |
- Sequence of the immunogen: EEF2 (Lys32~Val233)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with Biotin. |
Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human), Cy3 |
4-PAC453Hu01-Cy3 | Cloud-Clone | - EUR 419.00
- EUR 4325.00
- EUR 1175.00
- EUR 545.00
- EUR 251.00
| |
- Sequence of the immunogen: EEF2 (Lys32~Val233)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2). This antibody is labeled with Cy3. |
In all instances, Archaea couldn’t be detected and the microbial mats have been basically composed of e-Proteobacteria. Inside this group, one phylotype (AlviH2) was discovered to dominate the libraries of three colonization units. Dominance of e-Proteobacteria within the libraries might replicate the vast physiological selection encountered inside this group or an adaptability of those microorganisms in the direction of their altering surroundings. Micro organism affiliated to the Cytophaga-Flavobacterium-Bacteroides group or to the e-Proteobacteria, that develop both chemo-organoheterotrophically by fermentation or chemolithoautotrophically with H2 as an electron donor and S levels /S2O32- or NO3- as a terminal electron acceptor, have been remoted from one of many microbial mat fashioned in 20 days.