Oligonucleotide primers based mostly on Borrelia burgdorferi sensu lato ospA gene sequences have been designed to be used within the PCR to kind all (SL primers) or every (GI to GIII primers) of the B. burgdorferi sensu lato genospecies concerned in Lyme illness. These genospecies-specific primers have been then used within the PCR on 24 organic fluids collected from 18 neuroborreliosis sufferers.

Among the many samples examined, 20 contained DNA from Borrelia garinii, 11 contained DNA from B. burgdorferi sensu stricto, and 10 contained DNA from Borrelia afzelii. In toto, 10 sufferers appeared to have been contaminated by a single genospecies and eight have been contaminated by a couple of Lyme disease-associated genospecies. Serum specimens from six sufferers have been absorbed with heterologous antigens and examined by Western blotting (immunoblotting).

In 4 instances, residual immunodetection revealed particular epitopes of genospecies additionally detected by PCR; in two of them, the concordant outcomes indicated pluri-infection of the sufferers. Within the different two instances, Western blotting confirmed particular antibodies for 2 genospecies of Borrelia, whereas PCR detected DNA from just one. In abstract, the information underscored the comparatively excessive prevalence of pluri-infections in Lyme illness and confirmed the affiliation of B. garinii with neuroborreliosis.

Essential roles of sphingosine-1-phosphate and platelet-derived growth factor in the maintenance of human embryonic stem cells.

Human embryonic stem cells (hESCs) have nice potential to be used in analysis and regenerative medication, however little or no is understood concerning the elements that keep these cells within the pluripotent state. We investigated the position of three main mitogenic brokers current in serum–sphingosine-1-phosphate (S1P), lysophosphatidic acid (LPA), and platelet-derived progress issue (PDGF)–in sustaining hESCs.

EEF1B2 antibody
70R-49683	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal EEF1B2 antibody

EEF1B2 antibody
70R-2143	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal EEF1B2 antibody raised against the middle region of EEF1B2

EEF1B2 Antibody
1-CSB-PA004634	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

EEF1B2 Antibody
1-CSB-PA335050DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EEF1B2 Antibody
1-CSB-PA335050DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EEF1B2 Antibody
43073-100ul	SAB	100ul	EUR 252.00

EEF1B2 antibody
39022-100ul	SAB	100ul	EUR 252.00

EEF1B2 cloning plasmid
CSB-CL335050HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 678 Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat Show more
Description: A cloning plasmid for the EEF1B2 gene.

EEF1B2 cloning plasmid
CSB-CL335050HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 678 Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat Show more
Description: A cloning plasmid for the EEF1B2 gene.

EEF1B2 Blocking Peptide
33R-9624	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1B2 antibody, catalog no. 70R-2143

EEF1B2 Blocking Peptide
20-abx062558	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

EEF1B2 Conjugated Antibody
C39022	SAB	100ul	EUR 397.00

EEF1B2 Conjugated Antibody
C43073	SAB	100ul	EUR 397.00

Anti-EEF1B2 antibody
PAab02643	Lifescience Market	100 ug	EUR 355.00

Anti-EEF1B2 antibody
PAab02644	Lifescience Market	100 ug	EUR 355.00

anti- EEF1B2 antibody
FNab02643	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: eukaryotic translation elongation factor 1 beta 2 Uniprot ID: P24534 Gene ID: 1933 Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

anti- EEF1B2 antibody
FNab02644	FN Test	100µg	EUR 505.25
Immunogen: eukaryotic translation elongation factor 1 beta 2 Uniprot ID: P24534 Gene ID: 1933 Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

anti- EEF1B2 antibody
FNab02645	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:1000-1:4000 IF: 1:50-1:500 Immunogen: eukaryotic translation elongation factor 1 beta 2 Uniprot ID: P24534 Gene ID: 1933 Research Area: Cancer, Metabolism
Description: Antibody raised against EEF1B2

Anti-EEF1B2 antibody
STJ28663	St John"s Laboratory	100 µl	EUR 413.00
Description: This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5" UTR.

Anti-eEF1B2(3A5)
YF-MA12778	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to eEF1B2

Human EEF1B2 shRNA Plasmid
20-abx951334	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EEF1B2 protein (His tag)
80R-1704	Fitzgerald	10 ug	EUR 305.00
Description: Purified recombinant Human EEF1B2 protein

EEF1B2 ELISA KIT|Human
EF009297	Lifescience Market	96 Tests	EUR 689.00

EEF1B2 Recombinant Protein (Human)
RP010198	ABM	100 ug	Ask for price

EEF1B2 Recombinant Protein (Human)
RP010201	ABM	100 ug	Ask for price

EEF1B2 Recombinant Protein (Rat)
RP199085	ABM	100 ug	Ask for price

EEF1B2 Recombinant Protein (Mouse)
RP130901	ABM	100 ug	Ask for price

[KO Validated] EEF1B2 Rabbit pAb
A6580-100ul	Abclonal	100 ul	EUR 410.00

[KO Validated] EEF1B2 Rabbit pAb
A6580-200ul	Abclonal	200 ul	EUR 571.00

[KO Validated] EEF1B2 Rabbit pAb
A6580-20ul	Abclonal	20 ul	EUR 221.00

[KO Validated] EEF1B2 Rabbit pAb
A6580-50ul	Abclonal	50 ul	EUR 287.00

EEF1B2 ORF Vector (Human) (pORF)
ORF003400	ABM	1.0 ug DNA	EUR 95.00

EEF1B2 ORF Vector (Human) (pORF)
ORF003401	ABM	1.0 ug DNA	EUR 95.00

Eef1b2 ORF Vector (Rat) (pORF)
ORF066363	ABM	1.0 ug DNA	EUR 506.00

Eef1b2 ORF Vector (Mouse) (pORF)
ORF043635	ABM	1.0 ug DNA	EUR 506.00

Human Elongation factor 1-beta (EEF1B2)
1-CSB-EP335050HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 51.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-beta(EEF1B2) expressed in E.coli

EEF1B2 sgRNA CRISPR Lentivector set (Human)
K0656701	ABM	3 x 1.0 ug	EUR 339.00

Eef1b2 sgRNA CRISPR Lentivector set (Mouse)
K4892201	ABM	3 x 1.0 ug	EUR 339.00

Eef1b2 sgRNA CRISPR Lentivector set (Rat)
K6406801	ABM	3 x 1.0 ug	EUR 339.00

EEF1B2 Protein Vector (Human) (pPB-C-His)
PV013597	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPB-N-His)
PV013598	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-HA)
PV013599	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-His)
PV013600	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPB-C-His)
PV013601	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPB-N-His)
PV013602	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-HA)
PV013603	ABM	500 ng	EUR 329.00

EEF1B2 Protein Vector (Human) (pPM-C-His)
PV013604	ABM	500 ng	EUR 329.00

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0656702	ABM	1.0 ug DNA	EUR 154.00

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0656703	ABM	1.0 ug DNA	EUR 154.00

EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0656704	ABM	1.0 ug DNA	EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4892202	ABM	1.0 ug DNA	EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4892203	ABM	1.0 ug DNA	EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4892204	ABM	1.0 ug DNA	EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6406802	ABM	1.0 ug DNA	EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6406803	ABM	1.0 ug DNA	EUR 154.00

Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6406804	ABM	1.0 ug DNA	EUR 154.00

EEF1B2 Protein Vector (Mouse) (pPB-C-His)
PV174538	ABM	500 ng	EUR 603.00

EEF1B2 Protein Vector (Mouse) (pPB-N-His)
PV174539	ABM	500 ng	EUR 603.00

EEF1B2 Protein Vector (Mouse) (pPM-C-HA)
PV174540	ABM	500 ng	EUR 603.00

EEF1B2 Protein Vector (Mouse) (pPM-C-His)
PV174541	ABM	500 ng	EUR 603.00

EEF1B2 3"UTR Luciferase Stable Cell Line
TU006618	ABM	1.0 ml	EUR 1521.00

EEF1B2 3"UTR GFP Stable Cell Line
TU056618	ABM	1.0 ml	EUR 1521.00

EEF1B2 Protein Vector (Rat) (pPB-C-His)
PV265450	ABM	500 ng	EUR 603.00

EEF1B2 Protein Vector (Rat) (pPB-N-His)
PV265451	ABM	500 ng	EUR 603.00

EEF1B2 Protein Vector (Rat) (pPM-C-HA)
PV265452	ABM	500 ng	EUR 603.00

EEF1B2 Protein Vector (Rat) (pPM-C-His)
PV265453	ABM	500 ng	EUR 603.00

Eef1b2 3"UTR GFP Stable Cell Line
TU253789	ABM	1.0 ml	Ask for price

Eef1b2 3"UTR Luciferase Stable Cell Line
TU105611	ABM	1.0 ml	Ask for price

Eef1b2 3"UTR Luciferase Stable Cell Line
TU203789	ABM	1.0 ml	Ask for price

Eef1b2 3"UTR GFP Stable Cell Line
TU155611	ABM	1.0 ml	Ask for price

Human Elongation Factor 1 Beta (EEF1B2) ELISA Kit
abx387053-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human Elongation factor 1- beta, EEF1B2 ELISA KIT
ELI-09610h	Lifescience Market	96 Tests	EUR 824.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV709587	ABM	1.0 ug DNA	EUR 316.00

EEF1B2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV709591	ABM	1.0 ug DNA	EUR 316.00

EEF1B2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV709592	ABM	1.0 ug DNA	EUR 316.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-100ug
QP7171-ec-100ug	EnQuireBio	100ug	EUR 408.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-10ug
QP7171-ec-10ug	EnQuireBio	10ug	EUR 200.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-1mg
QP7171-ec-1mg	EnQuireBio	1mg	EUR 1632.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-200ug
QP7171-ec-200ug	EnQuireBio	200ug	EUR 634.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-500ug
QP7171-ec-500ug	EnQuireBio	500ug	EUR 1060.00

Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-50ug
QP7171-ec-50ug	EnQuireBio	50ug	EUR 263.00

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
20-abx327551	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
20-abx321034	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
20-abx321927	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
20-abx005048	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
20-abx009314	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) Antibody
20-abx176322	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
abx232643-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
abx232644-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody
abx232645-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Recombinant Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2)
4-RPF022Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P24534 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Beta 2 expressed in: E.coli

Human Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) Protein
20-abx650632	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0656705	ABM	3 x 1.0 ug	EUR 376.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4892205	ABM	3 x 1.0 ug	EUR 376.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6406805	ABM	3 x 1.0 ug	EUR 376.00

EEF1B2 Eukaryotic Translation Elongation Factor 1 Beta 2 Human Recombinant Protein
PROTP24534	BosterBio	Regular: 5ug	EUR 317.00
Description: EEF1B2 Human Recombinant fused with an8 amino acid His tag at C-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 233 amino acids (1-225 a.a.) and having a molecular mass of 25.8kDa. The EEF1B2 is purified by proprietary chromatographic techniques.

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0656706	ABM	1.0 ug DNA	EUR 167.00

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0656707	ABM	1.0 ug DNA	EUR 167.00

EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0656708	ABM	1.0 ug DNA	EUR 167.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV709588	ABM	1.0 ug DNA	EUR 316.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV709589	ABM	1.0 ug DNA	EUR 374.00

EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV709590	ABM	1.0 ug DNA	EUR 374.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4892206	ABM	1.0 ug DNA	EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4892207	ABM	1.0 ug DNA	EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4892208	ABM	1.0 ug DNA	EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6406806	ABM	1.0 ug DNA	EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6406807	ABM	1.0 ug DNA	EUR 167.00

Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6406808	ABM	1.0 ug DNA	EUR 167.00

We present right here that though LPA doesn’t have an effect on hESC progress or differentiation, coincubation of S1P and PDGF in a serum-free tradition medium efficiently maintains hESCs in an undifferentiated state. Our research point out that signaling pathways activated by tyrosine kinase receptors act synergistically with these downstream from lysophospholipid receptors to keep up hESCs within the undifferentiated state. This research is the primary demonstration of a task for lysophospholipid receptor signaling within the upkeep of stem cell pluri-potentiality.