Oligonucleotide primers based mostly on Borrelia burgdorferi sensu lato ospA gene sequences have been designed to be used within the PCR to kind all (SL primers) or every (GI to GIII primers) of the B. burgdorferi sensu lato genospecies concerned in Lyme illness. These genospecies-specific primers have been then used within the PCR on 24 organic fluids collected from 18 neuroborreliosis sufferers.
Among the many samples examined, 20 contained DNA from Borrelia garinii, 11 contained DNA from B. burgdorferi sensu stricto, and 10 contained DNA from Borrelia afzelii. In toto, 10 sufferers appeared to have been contaminated by a single genospecies and eight have been contaminated by a couple of Lyme disease-associated genospecies. Serum specimens from six sufferers have been absorbed with heterologous antigens and examined by Western blotting (immunoblotting).
In 4 instances, residual immunodetection revealed particular epitopes of genospecies additionally detected by PCR; in two of them, the concordant outcomes indicated pluri-infection of the sufferers. Within the different two instances, Western blotting confirmed particular antibodies for 2 genospecies of Borrelia, whereas PCR detected DNA from just one. In abstract, the information underscored the comparatively excessive prevalence of pluri-infections in Lyme illness and confirmed the affiliation of B. garinii with neuroborreliosis.
Essential roles of sphingosine-1-phosphate and platelet-derived growth factor in the maintenance of human embryonic stem cells.
Human embryonic stem cells (hESCs) have nice potential to be used in analysis and regenerative medication, however little or no is understood concerning the elements that keep these cells within the pluripotent state. We investigated the position of three main mitogenic brokers current in serum–sphingosine-1-phosphate (S1P), lysophosphatidic acid (LPA), and platelet-derived progress issue (PDGF)–in sustaining hESCs.
EEF1B2 antibody |
70R-49683 | Fitzgerald | 100 ul | EUR 244.00 |
Description: Purified Polyclonal EEF1B2 antibody |
EEF1B2 antibody |
70R-2143 | Fitzgerald | 50 ug | EUR 467.00 |
Description: Rabbit polyclonal EEF1B2 antibody raised against the middle region of EEF1B2 |
EEF1B2 Antibody |
1-CSB-PA004634 | Cusabio | | |
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000 |
EEF1B2 Antibody |
1-CSB-PA335050DSR1HU | Cusabio | | |
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
EEF1B2 Antibody |
1-CSB-PA335050DSR2HU | Cusabio | | |
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against EEF1B2. Recognizes EEF1B2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
EEF1B2 Antibody |
43073-100ul | SAB | 100ul | EUR 252.00 |
EEF1B2 antibody |
39022-100ul | SAB | 100ul | EUR 252.00 |
EEF1B2 cloning plasmid |
CSB-CL335050HU1-10ug | Cusabio | 10ug | EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 678
- Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat
- Show more
|
Description: A cloning plasmid for the EEF1B2 gene. |
EEF1B2 cloning plasmid |
CSB-CL335050HU2-10ug | Cusabio | 10ug | EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 678
- Sequence: atgggtttcggagacctgaaaagccctgccggcctccaggtgctcaacgattacctggcggacaagagctacatcgaggggtatgtgccatcacaagcagatgtggcagtatttgaagccgtgtccagcccaccgcctgccgacttgtgtcatgccctacgttggtataatcacat
- Show more
|
Description: A cloning plasmid for the EEF1B2 gene. |
EEF1B2 Blocking Peptide |
33R-9624 | Fitzgerald | 100 ug | EUR 180.00 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF1B2 antibody, catalog no. 70R-2143 |
EEF1B2 Blocking Peptide |
20-abx062558 | Abbexa | | |
- Shipped within 5-10 working days.
|
EEF1B2 Conjugated Antibody |
C39022 | SAB | 100ul | EUR 397.00 |
EEF1B2 Conjugated Antibody |
C43073 | SAB | 100ul | EUR 397.00 |
Anti-EEF1B2 antibody |
PAab02643 | Lifescience Market | 100 ug | EUR 355.00 |
Anti-EEF1B2 antibody |
PAab02644 | Lifescience Market | 100 ug | EUR 355.00 |
anti- EEF1B2 antibody |
FNab02643 | FN Test | 100µg | EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: eukaryotic translation elongation factor 1 beta 2
- Uniprot ID: P24534
- Gene ID: 1933
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against EEF1B2 |
anti- EEF1B2 antibody |
FNab02644 | FN Test | 100µg | EUR 505.25 |
- Immunogen: eukaryotic translation elongation factor 1 beta 2
- Uniprot ID: P24534
- Gene ID: 1933
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against EEF1B2 |
anti- EEF1B2 antibody |
FNab02645 | FN Test | 100µg | EUR 585.00 |
- Recommended dilution: WB: 1:1000-1:4000
- IF: 1:50-1:500
- Immunogen: eukaryotic translation elongation factor 1 beta 2
- Uniprot ID: P24534
- Gene ID: 1933
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against EEF1B2 |
Anti-EEF1B2 antibody |
STJ28663 | St John"s Laboratory | 100 µl | EUR 413.00 |
Description: This gene encodes a translation elongation factor. The protein is a guanine nucleotide exchange factor involved in the transfer of aminoacylated tRNAs to the ribosome. Alternative splicing results in three transcript variants which differ only in the 5" UTR. |
Anti-eEF1B2(3A5) |
YF-MA12778 | Abfrontier | 100 ug | EUR 363.00 |
Description: Mouse monoclonal to eEF1B2 |
Human EEF1B2 shRNA Plasmid |
20-abx951334 | Abbexa | | |
- Shipped within 15-20 working days.
|
EEF1B2 protein (His tag) |
80R-1704 | Fitzgerald | 10 ug | EUR 305.00 |
Description: Purified recombinant Human EEF1B2 protein |
EEF1B2 ELISA KIT|Human |
EF009297 | Lifescience Market | 96 Tests | EUR 689.00 |
EEF1B2 Recombinant Protein (Human) |
RP010198 | ABM | 100 ug | Ask for price |
EEF1B2 Recombinant Protein (Human) |
RP010201 | ABM | 100 ug | Ask for price |
EEF1B2 Recombinant Protein (Rat) |
RP199085 | ABM | 100 ug | Ask for price |
EEF1B2 Recombinant Protein (Mouse) |
RP130901 | ABM | 100 ug | Ask for price |
[KO Validated] EEF1B2 Rabbit pAb |
A6580-100ul | Abclonal | 100 ul | EUR 410.00 |
[KO Validated] EEF1B2 Rabbit pAb |
A6580-200ul | Abclonal | 200 ul | EUR 571.00 |
[KO Validated] EEF1B2 Rabbit pAb |
A6580-20ul | Abclonal | 20 ul | EUR 221.00 |
[KO Validated] EEF1B2 Rabbit pAb |
A6580-50ul | Abclonal | 50 ul | EUR 287.00 |
EEF1B2 ORF Vector (Human) (pORF) |
ORF003400 | ABM | 1.0 ug DNA | EUR 95.00 |
EEF1B2 ORF Vector (Human) (pORF) |
ORF003401 | ABM | 1.0 ug DNA | EUR 95.00 |
Eef1b2 ORF Vector (Rat) (pORF) |
ORF066363 | ABM | 1.0 ug DNA | EUR 506.00 |
Eef1b2 ORF Vector (Mouse) (pORF) |
ORF043635 | ABM | 1.0 ug DNA | EUR 506.00 |
Human Elongation factor 1-beta (EEF1B2) |
1-CSB-EP335050HU | Cusabio | - EUR 380.00
- EUR 214.00
- EUR 1309.00
- EUR 560.00
- EUR 873.00
- EUR 262.00
| - 100ug
- 10ug
- 1MG
- 200ug
- 500ug
- 50ug
|
- MW: 51.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 1-beta(EEF1B2) expressed in E.coli |
EEF1B2 sgRNA CRISPR Lentivector set (Human) |
K0656701 | ABM | 3 x 1.0 ug | EUR 339.00 |
Eef1b2 sgRNA CRISPR Lentivector set (Mouse) |
K4892201 | ABM | 3 x 1.0 ug | EUR 339.00 |
Eef1b2 sgRNA CRISPR Lentivector set (Rat) |
K6406801 | ABM | 3 x 1.0 ug | EUR 339.00 |
EEF1B2 Protein Vector (Human) (pPB-C-His) |
PV013597 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPB-N-His) |
PV013598 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPM-C-HA) |
PV013599 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPM-C-His) |
PV013600 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPB-C-His) |
PV013601 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPB-N-His) |
PV013602 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPM-C-HA) |
PV013603 | ABM | 500 ng | EUR 329.00 |
EEF1B2 Protein Vector (Human) (pPM-C-His) |
PV013604 | ABM | 500 ng | EUR 329.00 |
EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0656702 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0656703 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF1B2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0656704 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4892202 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4892203 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1b2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4892204 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6406802 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6406803 | ABM | 1.0 ug DNA | EUR 154.00 |
Eef1b2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6406804 | ABM | 1.0 ug DNA | EUR 154.00 |
EEF1B2 Protein Vector (Mouse) (pPB-C-His) |
PV174538 | ABM | 500 ng | EUR 603.00 |
EEF1B2 Protein Vector (Mouse) (pPB-N-His) |
PV174539 | ABM | 500 ng | EUR 603.00 |
EEF1B2 Protein Vector (Mouse) (pPM-C-HA) |
PV174540 | ABM | 500 ng | EUR 603.00 |
EEF1B2 Protein Vector (Mouse) (pPM-C-His) |
PV174541 | ABM | 500 ng | EUR 603.00 |
EEF1B2 3"UTR Luciferase Stable Cell Line |
TU006618 | ABM | 1.0 ml | EUR 1521.00 |
EEF1B2 3"UTR GFP Stable Cell Line |
TU056618 | ABM | 1.0 ml | EUR 1521.00 |
EEF1B2 Protein Vector (Rat) (pPB-C-His) |
PV265450 | ABM | 500 ng | EUR 603.00 |
EEF1B2 Protein Vector (Rat) (pPB-N-His) |
PV265451 | ABM | 500 ng | EUR 603.00 |
EEF1B2 Protein Vector (Rat) (pPM-C-HA) |
PV265452 | ABM | 500 ng | EUR 603.00 |
EEF1B2 Protein Vector (Rat) (pPM-C-His) |
PV265453 | ABM | 500 ng | EUR 603.00 |
Eef1b2 3"UTR GFP Stable Cell Line |
TU253789 | ABM | 1.0 ml | Ask for price |
Eef1b2 3"UTR Luciferase Stable Cell Line |
TU105611 | ABM | 1.0 ml | Ask for price |
Eef1b2 3"UTR Luciferase Stable Cell Line |
TU203789 | ABM | 1.0 ml | Ask for price |
Eef1b2 3"UTR GFP Stable Cell Line |
TU155611 | ABM | 1.0 ml | Ask for price |
Human Elongation Factor 1 Beta (EEF1B2) ELISA Kit |
abx387053-96tests | Abbexa | 96 tests | EUR 911.00 |
- Shipped within 5-12 working days.
|
Human Elongation factor 1- beta, EEF1B2 ELISA KIT |
ELI-09610h | Lifescience Market | 96 Tests | EUR 824.00 |
EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV709587 | ABM | 1.0 ug DNA | EUR 316.00 |
EEF1B2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV709591 | ABM | 1.0 ug DNA | EUR 316.00 |
EEF1B2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV709592 | ABM | 1.0 ug DNA | EUR 316.00 |
Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-100ug |
QP7171-ec-100ug | EnQuireBio | 100ug | EUR 408.00 |
Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-10ug |
QP7171-ec-10ug | EnQuireBio | 10ug | EUR 200.00 |
Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-1mg |
QP7171-ec-1mg | EnQuireBio | 1mg | EUR 1632.00 |
Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-200ug |
QP7171-ec-200ug | EnQuireBio | 200ug | EUR 634.00 |
Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-500ug |
QP7171-ec-500ug | EnQuireBio | 500ug | EUR 1060.00 |
Recombinant Human EF1B/ EEF1B2 Protein, GST, E.coli-50ug |
QP7171-ec-50ug | EnQuireBio | 50ug | EUR 263.00 |
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
20-abx327551 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
20-abx321034 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
20-abx321927 | Abbexa | | |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
20-abx005048 | Abbexa | - EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
| |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
20-abx009314 | Abbexa | - EUR 300.00
- EUR 439.00
- EUR 189.00
| |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) Antibody |
20-abx176322 | Abbexa | - EUR 425.00
- EUR 133.00
- EUR 1205.00
- EUR 578.00
- EUR 328.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
abx232643-100ug | Abbexa | 100 ug | EUR 481.00 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
abx232644-100ug | Abbexa | 100 ug | EUR 481.00 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1B2) Antibody |
abx232645-100ug | Abbexa | 100 ug | EUR 551.00 |
- Shipped within 5-12 working days.
|
Recombinant Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) |
4-RPF022Hu01 | Cloud-Clone | - EUR 413.60
- EUR 214.00
- EUR 1276.00
- EUR 492.00
- EUR 884.00
- EUR 340.00
- EUR 3040.00
| - 100 ug
- 10ug
- 1 mg
- 200 ug
- 500 ug
- 50ug
- 5 mg
|
- Uniprot ID: P24534
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.7kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Eukaryotic Translation Elongation Factor 1 Beta 2 expressed in: E.coli |
Human Eukaryotic Translation Elongation Factor 1 Beta 2 (EEF1b2) Protein |
20-abx650632 | Abbexa | - EUR 578.00
- EUR 258.00
- EUR 1720.00
- EUR 690.00
- EUR 425.00
| - 100 ug
- 10 ug
- 1 mg
- 200 ug
- 50 ug
|
- Shipped within 5-7 working days.
|
EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
K0656705 | ABM | 3 x 1.0 ug | EUR 376.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
K4892205 | ABM | 3 x 1.0 ug | EUR 376.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
K6406805 | ABM | 3 x 1.0 ug | EUR 376.00 |
EEF1B2 Eukaryotic Translation Elongation Factor 1 Beta 2 Human Recombinant Protein |
PROTP24534 | BosterBio | Regular: 5ug | EUR 317.00 |
Description: EEF1B2 Human Recombinant fused with an8 amino acid His tag at C-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 233 amino acids (1-225 a.a.) and having a molecular mass of 25.8kDa. The EEF1B2 is purified by proprietary chromatographic techniques. |
EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
K0656706 | ABM | 1.0 ug DNA | EUR 167.00 |
EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
K0656707 | ABM | 1.0 ug DNA | EUR 167.00 |
EEF1B2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
K0656708 | ABM | 1.0 ug DNA | EUR 167.00 |
EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
LV709588 | ABM | 1.0 ug DNA | EUR 316.00 |
EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
LV709589 | ABM | 1.0 ug DNA | EUR 374.00 |
EEF1B2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
LV709590 | ABM | 1.0 ug DNA | EUR 374.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
K4892206 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
K4892207 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
K4892208 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K6406806 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
K6406807 | ABM | 1.0 ug DNA | EUR 167.00 |
Eef1b2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
K6406808 | ABM | 1.0 ug DNA | EUR 167.00 |
We present right here that though LPA doesn’t have an effect on hESC progress or differentiation, coincubation of S1P and PDGF in a serum-free tradition medium efficiently maintains hESCs in an undifferentiated state. Our research point out that signaling pathways activated by tyrosine kinase receptors act synergistically with these downstream from lysophospholipid receptors to keep up hESCs within the undifferentiated state. This research is the primary demonstration of a task for lysophospholipid receptor signaling within the upkeep of stem cell pluri-potentiality.